Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br Cell cycle was analyzed using a Cell Cycle

    2020-08-04


    Cell cycle was analyzed using a Cell Cycle Detection Kit (Keygentec, Nanjing, China). A549 cells were harvested and washed twice with PBS at 24 h after treatments. Cells were then fixed in 1 ml 70% pre-cooled ethanol at 4 ℃ overnight, followed by incubation with 100 mg/l RNaseA at 37℃ for 30 min. Cells were stained with 50 mg/l propidium iodide (PI) at 4 ℃ for 30 min in darkness, and cells were detected on FACScalibur flow cytometry (BD Biosciences, San Jose, CA, USA) with the excitation wavelength at 488 nm. Data were analyzed with FlowJo  Pathology - Research and Practice 215 (2019) 152379
    software (Tree Star, Ashland, OR, USA).
    Total RNA was extracted from A549 cells using TRIzol reagent (Thermo Fisher Scientific) and reverse transcribed with RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). RT products were used as templates for qRT-PCR. The mRNA levels of the target genes were analyzed by SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific) according to the manufacturer’s instruction (n = 3, each in triplicate). GAPDH was used as an internal control for normalization. The specificity of the fluorescence signal was confirmed by both melting curve and agarose gel electrophoresis. The mRNA levels of target genes were determined by 2 –TΔΔC method. The primers were synthesized by SanGon (China). Primers for RT-qPCR sequences are as follows (from 5′ to 3′): SOX2-F, GGAGAGTAAGAAACAGCATGGA; SOX2-R, GTGGATGGG ATTGGTGTTCT; 4-Oct-F, CAGGAGATATGCAAAGCAGAAAC; 4-Oct-R, GGCACTGCAGGAACAAATTC; ALDH1-F, GTCAAACCAGCAGAGCA AAC; ALDH1-R, GGCCCATAACCAGGAACAATA; COX-2-F, CTATGTGC TAGCCCACAAAGA; COX-2-R, GCATCCACAGATCCCTCAAA; HIF-1a-F, GTCTGCAACATGGAAGGTATTG; HIF-1a-R, GCAGGTCATAGGTGGTT TCT; GAPDH-F, GGTGTGAACCATGAGAAGTATGA; GAPDH-R, GAGTC CTTCCACGATACCAAAG.
    2.5. Western blotting
    Protein extracts were prepared in RIPA lysis buffer. Total protein concentration was determined by BCA Protein Assay Kit (KeyGEN Biotech, Nanjing, China). An equal amount of protein extracts were resolved by SDS-PAGE and transferred onto the PVDF membrane (Millipore, Billerica, MA, USA). The membrane was blocked with 5% non-fat milk, followed by incubation with corresponding primary and secondary antibodies. Primary (-)-Bicuculline methiodide against SOX2 (AF5140), ALDH1 (DF6225), COX-2 (AF7003), HIF-1α (AF1009) were obtained from Affinity Biosciences (Cincinnati, OH, USA). Anti-OCT4 (ab181557), anti-calnexin (ab133615) and anti-GAPDH (ab8245) were purchased from Abcam (Cambridge, MA, USA). Anti-CD63 (Ap5333b) and anti-CD81 (Am8557b) were from Abgent (San Diego, CA, USA). ECL Western blotting detection reagents (Beyotime) were used for protein detection. The X-ray films were scanned, and bands were ana-lyzed by ImageQuant™ LAS 500 (GE Healthcare, Piscataway, NJ, USA).
    2.6. Enzyme-linked immunosorbent assay (ELISA)
    Specific ELISA kit for human prostaglandin E2 (PGE2, Bio-Swamp, Shanghai, China) was used to quantify the level of PGE2 in cell culture supernatant according to the manufacturer’s instructions.
    2.7. Aldefluor assay and separation of the ALDH subpopulations by FACS
    The Aldefluor reagent (Stem Cell Technologies, Vancouver, Canada) was used to isolate subpopulations with high aldehyde dehydrogenase (ALDH) activity. In brief, A549 cells were collected and resuspended in ALDEFLUOR assay buffer containing ALDH substrate (BAAA, 1 μmol/l per 1 × 106 cells), followed by incubation at 37℃ for 50 min in dark-ness. For each sample, an aliquot of cells was treated with 50 mmol/l diethylamino benzaldehyde (DEAB), an ALDH specific inhibitor, as a negative control. The sorting gates were established using Aldefluor-stained negative controls. Labeled cells were sorted with MoFlo XDP cell sorter (Beckman Coulter, Miami, FL, USA). After sorting, ALDH1+ cells and ALDH1− cells were cultured in DMEM/F12 (Hyclone, Logan, UT, USA) supplemented with 20 mg/l EGF, 20 mg/l bFGF, 1% B27, 0.1% BSA, 5 mmol/l HEPES, 4 mmol/l Glutamine, 100 U/l penicillin and 100 mg/l streptomycin.
    Fig. 1. Effects of aspirin on A549 cell proliferation and cell cycle. (A) Cell viability was detected after 0, 12, 24, 48, or 72 h hypoxic culture by CCK-8 assay. (B) Cell cycle was analyzed by FACS after 24 h of hypoxic culture. The data reported are the representative results of three independent experiments. (C) Quantitative analysis of the cell cycle. The data reported are the representative results of three independent experiments; * indicates P < 0.05, ** indicates P < 0.01.
    2.8. Isolation and analysis of exosomes
    A549 cells were cultured in RMPI-1640 supplemented with 10% exosome-depleted FBS for 48 h. Exosomes were extracted using the ExoQuick-TC kit (System Biosciences, Mountain View, CA, USA)